| Worm gene name: | PAH-1 |
| Worm sequence name: | K08F8.4 |
| Related human gene: | phenylalanine hydroxylase |
| Associated human disease: | phenylketonuria |
| People involved in this project: |
|
| Left primer sequence: | ccgctccaaaatacacacct |
| Right primer sequence: | gatggtagctgcccatgatt |
| Size of PCR product: | 401 |
| Brief description: | Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism resulting from a deficiency of phenylalanine hydroxylase (EC 1.14.16.1), an enzyme that catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine catabolism. The reaction is dependent on tetrahydrobiopterin (BH4), as a cofactor, molecular oxygen, and iron. If undiagnosed and untreated, phenylketonuria can result in impaired postnatal cognitive development resulting from a neurotoxic effect of hyperphenylalaninemia. (from OMIM) |
| Report any problems that might have appeared and any solutions: | |
Primers did not result in a successful amplicon (tried twice). According to Wormbase BLAST, using the primer sequences given above, product should have been 665nt, not 401nt.