Worm gene name:  W03D8.8
Worm sequence name:  Peroxisomal long chain acyl-CoA thioesterase I
Related human gene:  NP_689544
Associated human disease:  Alzheimer Disease
People involved in this project: 
Left primer sequence:  gaaattttcaaatccggcaa
Right primer sequence:  tcacttccgcttcacttcct
Size of PCR product:  346
Brief description:  Alzheimer's disease is a progressive, degenerative disease of the brain in which brain cells die and are not replaced. It results in impaired memory, thinking and behaviour, and is the most common form of dementing illness. The early-stage is where the patient struggled with problems with memory, thinking and concentration. Currently, there is no cure for Alzheimer's Disease. But drug and non-drug treatments may help with both cognitive and behavioral symptoms.
Report any problems that might have appeared and any solutions:  Nil