| Worm gene name: | fbl-1 |
| Worm sequence name: | F56H11.1 |
| Related human gene: | fibrillin-1 |
| Associated human disease: | Marfan's syndrome |
| People involved in this project: |
|
| Left primer sequence: | accggatggaagaacttgtg |
| Right primer sequence: | ctgcatgatttggagcagaa |
| Size of PCR product: | 548 |
| Brief description: | Marfan syndrome is a connective-tissue disorder inherited as an autosomal dominant trait. Approximately 25% of cases are caused by a spontaneous mutation. Marfan syndrome affects the long bones of the skeleton. Therefore the arms, legs, fingers, and toes may be disproportionately long in relation to the rest of the body. A common feature of the disorder is tall stature. More than half of all people with the Marfan syndrome experience dislocation of one or both lenses of the eye. Most people with the Marfan syndrome have problems associated with the heart and blood vessels. Many times the connective tissue of the aorta becomes so weakened it ruptures.
I used the NCBI web page to find that the fibrillin-1 gene was associated with Marfan's. I then used NCBI to find the homologous gene in C. elegans. I then went to E-RNAi website to design primers of the fbl-1 gene. I did not have time to go any further in the project. |
| Report any problems that might have appeared and any solutions: | |
