| Worm gene name: | Y50D7A.10 |
| Worm sequence name: | Y50D7A.10 |
| Related human gene: | GMF-B |
| Associated human disease: | neural regeneration, cancer |
| People involved in this project: |
|
| Left primer sequence: | cggagtgaaggaggatttga |
| Right primer sequence: | gacgatgaaattacggctcc |
| Size of PCR product: | 301 |
| Brief description: | Glial maturation factor beta was first linked to differentiation of brain cells, and later shown to aid neural regeneration and limit proliferation of tumor cells. |
| Report any problems that might have appeared and any solutions: | |
