Worm gene name:  Y50D7A.10
Worm sequence name:  Y50D7A.10
Related human gene:  GMF-B
Associated human disease:  neural regeneration, cancer
People involved in this project: 
Left primer sequence:  cggagtgaaggaggatttga
Right primer sequence:  gacgatgaaattacggctcc
Size of PCR product:  301
Brief description:  Glial maturation factor beta was first linked to differentiation of brain cells, and later shown to aid neural regeneration and limit proliferation of tumor cells.
Report any problems that might have appeared and any solutions: 
View(0) or add comments