Worm gene name:  cep-1
Worm sequence name:  F52B5.5a
Related human gene:  TRP 53
Associated human disease:  tumor
People involved in this project: 
Left primer sequence:  gtcttcatggatgcgttcct
Right primer sequence:  ccgtttgcattgaacaacac
Size of PCR product:  393
Brief description:  Right primer starts at 4044 and left primer starts at 4436.
Report any problems that might have appeared and any solutions: 
View(0) or add comments