| Worm gene name: | ctb-1 |
| Worm sequence name: | MTCE.21 |
| Related human gene: | mitochondrial cytochrome b |
| Associated human disease: | Parkinson's |
| People involved in this project: |
|
| Left primer sequence: | cgcccgataggttaatagca |
| Right primer sequence: | tggccctcaaattggaataa |
| Size of PCR product: | 308 |
| Brief description: | There is some evidence to indicate that a defect in the gene encoding the mitochondrial electron transport protein, cytoshrome Ib, is involved in Parkinson's disease in humans. This may lead to a devastating loss of ATP synthesis in the tissues of the brain. Why this would affect specific regions of the brain, specifically the substantia nigra is not known. |
| Report any problems that might have appeared and any solutions: | |
