Worm gene name:  R05H5.7
Worm sequence name:  R05H5.7
Related human gene:  MVCD1
Associated human disease:  Diabetes
People involved in this project: 
Left primer sequence:  catacaaattgccagcaatc
Right primer sequence:  ttattgccacaacaatatcc
Size of PCR product:  0
Brief description:  In Humans: microvascular complications, retinopathy
In Worms: ?
Report any problems that might have appeared and any solutions: