| Worm gene name: | Y53g8ar.8 |
| Worm sequence name: | Y53g8ar.8 |
| Related human gene: | HBB |
| Associated human disease: | Sickle Cell Anemia |
| People involved in this project: |
|
| Left primer sequence: | agcatgaaccgggtctattg |
| Right primer sequence: | tttttgcaaaattttttttc |
| Size of PCR product: | 20 |
| Brief description: | Human:episodes of acute illness and progressive organ damage. Worms: causes problems with excretory cells; Nervous System; head neurons; pharyngeal neurons; unidentified cells in tail |
| Report any problems that might have appeared and any solutions: | |
