| Worm gene name: | msh-6 |
| Worm sequence name: | Y47G6A.11 |
| Related human gene: | MSH6 |
| Associated human disease: | Hereditary nonpolyposis colorectal cancer |
| People involved in this project: |
|
| Left primer sequence: | actcgaatctggaatttgcc |
| Right primer sequence: | gagcacattcaacaagatgtcg |
| Size of PCR product: | 158 |
| Brief description: | HNPCC, also known as Lynch syndrome, is a disorder that increases the risk of many types of cancer in colon and recum. It may also increase probabilities of cancer in stomach , small intestine, liver, bladder, urinary tract, brain, skin, and ovaries and uterus in women.
Gene MSH6 -mutS homolog6 (E. Coli)- located in 2p16 and member of the mismatch repair genes (MMR), joins with gene MSH2 and forms protein complex to identify mistakes during DNA replication. Variations in this gene allow abnormal cells to divide, leading to unconrolled cell growth, and therefore cancer. With C. elegans,variations in this gene (msh-6) also lead to disease. |
| Report any problems that might have appeared and any solutions: | none |
