| Worm gene name: | cdk-1 |
| Worm sequence name: | T05G5.3 |
| Related human gene: | cdk-1 |
| Associated human disease: | cancer |
| People involved in this project: |
|
| Left primer sequence: | gctgtgcgagagatcagctt |
| Right primer sequence: | taagagtttcgagcggaagg |
| Size of PCR product: | 175 |
| Brief description: | The gene codes for a protein that is vital during cell division. The presence of the protein complex is necessary for mitosis. if there is an error, then mitosis does not continue. |
| Report any problems that might have appeared and any solutions: | none |
