| Worm gene name: | hlh-30 |
| Worm sequence name: | W02c12.3b |
| Related human gene: | Mitf |
| Associated human disease: | pigmentation & developmental function disorders |
| People involved in this project: |
|
| Left primer sequence: | gtacccccattaatttgccc |
| Right primer sequence: | agtcgaatcgaatcagaggg |
| Size of PCR product: | 329 |
| Brief description: | Protein-coding gene that plays the role in development, survival, and function of certain cells; it helps in the function of pigment-producing cells for hair, eye, and skin cells particularily in humans. |
| Report any problems that might have appeared and any solutions: | The primer T7 created a longer than expected base pair sequence; this could have been due to the forward and reverse primers containing the same sequence, which caused one of the primers to replicate the entire sequence of the plasmid before the other primer could anneal. From this, our gel from the electrophoresis produced a band close to the length of the entire plasmid, which was around 3,000 base pairs.
After introducing the engineered RNAi feeding strain to L4 stage worms, the phenotype showed the worms to be thinner, have less progeny, and speckled along their bodylength. They also appeared to be sensitive to light when placed under the microscope. In order to prevent the amplicon from being so long, a possible solution could be to use different forward and reverse primers. |
