| Worm gene name: | tub-1 |
| Worm sequence name: | F10B5.4 |
| Related human gene: | FUR1 |
| Associated human disease: | Obesity |
| People involved in this project: |
|
| Left primer sequence: | aaaactacaaatcacgcggc |
| Right primer sequence: | gggagcaaccgagattgtta |
| Size of PCR product: | 662 |
| Brief description: | This gene involves regulation of fat storage in the head and in the tail region. |
| Report any problems that might have appeared and any solutions: | The expected results using this gene were that the worms should exhibit a "tubby" or larger than normal body size. The experiment was successful, in that when a feeding strain was constructed and used, the phenotype observed was that the worms were significantly larger all around when compared to the wild type worms. |
