Worm gene name:  ceh-45
Worm sequence name:  ZK993.1
Related human gene:  Goosecoid
Associated human disease:  Involved in early embryogenesis
People involved in this project: 
Left primer sequence:  accatcaacactacgcctcc
Right primer sequence:  aactacacggccaaggattg
Size of PCR product:  300
Brief description:  Interested in embryo implantation and read reports on this gene that is hoghly conserved in human, mouse and frogs.
Report any problems that might have appeared and any solutions:  Low efficiency, but this can hopefully be improved.