Worm gene name:  xpa-1
Worm sequence name:  K07G5.2
Related human gene:  Xeroderma Pigmentosum comp group A
Associated human disease:  Xeroderma Pigmentosum
People involved in this project: 
Left primer sequence:  aattttcaggcgaagaagca
Right primer sequence:  ttcggaacgaacttctttgg
Size of PCR product:  474
Brief description:  There are 5 exons and 4 introns with a nonexpressed DNA section at the end.
Report any problems that might have appeared and any solutions:  none