| Worm gene name: | Sod-1 |
| Worm sequence name: | C115F1.7a |
| Related human gene: | Sod-1 |
| Associated human disease: | Amyotrophic Lateral Sclerosis |
| People involved in this project: |
|
| Left primer sequence: | tggatcacacagaagtccga |
| Right primer sequence: | acaaccatagatcggccaac |
| Size of PCR product: | 302 |
| Brief description: | A mutation in the S0D-1 in humans is associated with ALS. The mutation in the gene in the C. elegans worm is associated with a phenotypic expression demonstrating slow-growth. Using RNAi I would like to demonstrate the phenotypic changes using the primer from the eRNAi website. |
| Report any problems that might have appeared and any solutions: | In WormBase a similar experiment has been done with different primers. |
