Worm gene name:  Ceh-10
Worm sequence name:  W03A3.1
Related human gene:  vsx1
Associated human disease:  craniofacial abnormalities
People involved in this project: 
Left primer sequence:  gatcgacgaactcgagaagg
Right primer sequence:  ctgatgttggggagcttgtt
Size of PCR product:  463
Brief description:  This is a homeobox gene important for development of head and retina.
Report any problems that might have appeared and any solutions: 
View(0) or add comments