| Worm gene name: | F36H5.4 |
| Worm sequence name: | F36H5.4 |
| Related human gene: | dystrophin |
| Associated human disease: | DMD |
| People involved in this project: |
|
| Left primer sequence: | tacattgcggaagtcaacca |
| Right primer sequence: | aaatgcaaagtgtgtgcagc |
| Size of PCR product: | 523 |
| Brief description: | muscular dystrophy is a genetic disease resulting from a deletion in group of genes associated with the production of normal muscle protein named dystrophin. |
| Report any problems that might have appeared and any solutions: | |
