| Worm gene name: | Prdx-2 |
| Worm sequence name: | F09E5.15a.1 |
| Related human gene: | peroxiredoxin |
| Associated human disease: | increased sensitivity to sublethal doses of H2O2 and resistance to heavy metal |
| People involved in this project: |
|
| Left primer sequence: | gaaagccagctccacaattc |
| Right primer sequence: | caaacctctccgtgcttctc |
| Size of PCR product: | 554 |
| Brief description: | explore the effect of silencing Prdx-2 on worms and its role in antioxidant defence against envionmental radiation. |
| Report any problems that might have appeared and any solutions: | none |
