| Worm gene name: | FRM-1 |
| Worm sequence name: | ZK270.2 |
| Related human gene: | TERT |
| Associated human disease: | death |
| People involved in this project: |
|
| Left primer sequence: | ctcacccaagcagactgtga |
| Right primer sequence: | gaacacgagcaatcagacga |
| Size of PCR product: | 374 |
| Brief description: | erythrocyte membrane protein. Ortholog to hTERT gene for telomerase catalization. |
| Report any problems that might have appeared and any solutions: | |
