Worm gene name:  stn-2
Worm sequence name:  F27D9.8
Related human gene:  syntrophin
Associated human disease:  not known
People involved in this project: 
  • Ray Hong, California State University, Northridge, CA
Left primer sequence:  tccgttacgaaatcacacca
Right primer sequence:  ggctggcaatcctttgaata
Size of PCR product:  306
Brief description:  Iin C. elegans, this protein is associated with neurons and muscles, and is known to cause abnormal locomotion and head movements
Report any problems that might have appeared and any solutions: