| Worm gene name: | pxl-1 |
| Worm sequence name: | C28H8.6b |
| Related human gene: | paxillin |
| Associated human disease: | none known? (Neurofibromatosis type II?) |
| People involved in this project: |
|
| Left primer sequence: | ggtctccatcaagagaccca |
| Right primer sequence: | acatccttggcactttggac |
| Size of PCR product: | 549 |
| Brief description: | Neurofibromatosis type II is an autosomal dominant disorder (cancer) that results in tumors (schwannomas) in the nervous system. Loss of NF2 has also been associated with other cancers, including mesotheliomas. Mutations of NF2 (particularly in the region of exon 2&3) result in loss-of-function and/or undetectable levels of protein. Paxillin (a protein involved in recruitment of signaling and other molecules to focal adhesions) is known to bind to the NF2 gene product (called, schwannomin or merlin) in the region of amino acids encoded by exon 2. Deletion of exon 2 in merlin prevents its binding to paxillin and its proper localization to the membrane where it interacts with beta-1-integrin.(Fernandez-Valle et al., 2002) Though mutations in paxillin have not been associated with the disease NF2, I am interested in learning about paxillin. By using RNAi in C elegans, we may be able to study its role as a cell adhesion molecule and potential other functions. In addition, since paxillin interacts with several proteins (including NF2) known to cause cell transformation, the binding sites for these proteins on paxillin may represent potential targets for therapeutic agents (including RNAi). (Turner, 1998) |
| Report any problems that might have appeared and any solutions: | |
