Worm gene name:  K02D7.1
Worm sequence name:  K02D7.1
Related human gene:  NP
Associated human disease:  Deficiency of nucleoside phosphorylase results in defective T-cell immunity
People involved in this project: 
Left primer sequence:  cgcctcaatcagagagcaag
Right primer sequence:  tccaccggacatcacataga
Size of PCR product:  744
Brief description:  Nil
Report any problems that might have appeared and any solutions:  Nil
View(0) or add comments